IthaID: 3683
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
---|---|---|---|
Common Name: | IVS II-308 (-A) | HGVS Name: | HBB:c.315+308delA |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
AAATATCTCTGAGATACATTAAGTAACTTAAAAAAAA [A/-] CTTTACACAGTCTGCCTAGTACATTACTATTTGGAATA (Strand: +)
Also known as:
Comments: Found in four cases (Chinese and Dusun) with mild decreased MCV and MCH levels. In one of the four cases, the novel mutation reported in combination with the Hb G-Honolulu [IthaID: 502] in a 16-year-old Chinese female presented with an elevated Hb A2 (19.6 %) level. Also, one additional case was reported in a 27-year-old Chinese female with no clinical presentation.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71347 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Chinese, Dusun |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Li, Youqiong | 2021-03-09 | Report of an update. |
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-10-27 14:08:39 | The IthaGenes Curation Team | Created |
2 | 2021-03-10 20:41:25 | The IthaGenes Curation Team | Reviewed. Comment and contributor added. |
3 | 2022-09-22 14:50:57 | The IthaGenes Curation Team | Reviewed. Comment edit. |