IthaID: 3672

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	-73 A>C	HGVS Name:	HBB:c.-123A>C
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
CACCCTGTGGAGCCACACCCTAGGGTTGGCCA [A/C] TCTACTCCCAGGAGCAGGGAGGGCAGGAGCCA

Also known as:

Comments: Found in three Malay females with normal hematological presentation and only slightly increased Hb A2 levels (3.8%). The novel variant found in combination with the rightward –α3.7 deletion in one of the females.

External Links

No available links

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70472
Size:	1 bp
Located at:	β
Specific Location:	Promoter

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Malay
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/A	Contributor(s)	Date	Comments
1	Mohd Yasin, Norafiza	2020-10-20	First report.

Created on 2020-10-23 10:46:27, Last reviewed on (Show full history)

A/A	Date	Curator(s)	Comments
1	2020-10-23 10:46:27	The IthaGenes Curation Team	Created

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.