IthaID: 3666



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs2954930 HGVS Name: NC_000012.12:g.11899768G>A

Context nucleotide sequence:
AACCAGAAACAATCCACACATCCATT [G>A] ACTGGTGAATAGATAAATAAAATGT (Strand: +)

Also known as:

Comments: Associated with F-cell levels in a pediatric cohort with sickle cell anaemia from the Silent Cerebral Infarct Transfusion (SIT) trial.

External Links

Location

Chromosome: 12
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: ETV6-BCL2L14
Specific Location: N/A

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: F-cell numbers

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
Created on 2020-10-15 15:22:54, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.