IthaID: 3654



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7943316 HGVS Name: NG_013339.2:g.5001A>T

Context nucleotide sequence:
TTGGCTGAGCCTGAAGTCGCCACGG [A>T] CTCGGGGCAACAGGCAGATTTGCCT (Strand: +)

Also known as:

Comments: 2KB Upstream Variant; Associated with response to hydroxyurea treatment in patients with sickle cell anaemia based on observed alterations in laboratory biomarkers, including inflammatory parameters.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Response to hydroxyurea

Location

Chromosome: 11
Locus: NG_013339.2
Locus Location: 5001
Size: 1 bp
Located at: CAT
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Yahouédéhou SCMA, Neres JSDS, da Guarda CC, Carvalho SP, Santiago RP, Figueiredo CVB, Fiuza LM, Ndidi US, de Oliveira RM, Fonseca CA, Nascimento VML, Rocha LC, Adanho CSA, da Rocha TSC, Adorno EV, Goncalves MS, Sickle Cell Anemia: Variants in the , , and Genes Are Associated With Improved Hydroxyurea Response., Front Pharmacol, 11(0), 553064, 2020 PubMed
Created on 2020-10-13 12:42:25, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.