IthaID: 3636



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 104 (-A) HGVS Name: HBB:c.313delA
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TGCACGTGGATCCTGAGAACTTC [A/-] GGGTGAGTCTATGGGACGCTTGA (Strand: -)

Also known as:

Comments: Found in a 12-year-old Chinese boy in compound heterozygosity with HBB:c.126_129delCTTT [IthaID:147]. Patient presented severe β-thalassemia with moderate hemolytic anemia (Hb 125 g/dL, MCV 74.7 fL, MCH 21.9 pg, HbA2 5.1 %, HbF 0.7 %). The HBB:c.313delA deletion was also identified in the father.

External Links

No available links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71037
Size: 1 bp
Located at: β
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Qiu, Yuling2020-09-07First report.
Created on 2020-10-02 09:39:52, Last reviewed on 2020-10-02 09:48:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.