IthaID: 3627



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CAP +20 (-C) HGVS Name: HBB:c.-31delC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TTGCTTACATTTGCTTCTGACACAA [C/-] TGTGTTCACTAGCAACCTCAAA (Strand: -)

Also known as:

Comments: Reported in a heterozygous state in four individuals during routine screening.

External Links

No available links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70564
Size: 1 bp
Located at: β
Specific Location: 5'UTR

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Indian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Nadkarni AH, Gorakshakar AC, Sawant PM, Italia KY, Upadhye DS, Gorivale MS, Mehta PR, Hariharan P, Ghosh K, Colah RB, The phenotypic and molecular diversity of hemoglobinopathies in India: A review of 15 years at a referral center., Int J Lab Hematol, 41(2), 218-226, 2019 PubMed
Created on 2020-09-16 12:11:19, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.