IthaID: 3625



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2154586 HGVS Name: NC_000021.9:g.46603603G>A

Context nucleotide sequence:
TTTACCAGCTTTTGGCCTTGA [G>A] TTCTAATCATTAAATAAGAA (Strand: +)

Also known as:

Comments: The 'A' allele associated with avascular necrosis in adult (Walk-PHaSST) and pediatric (PUSH) cohorts with sickle cell disease.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805]

Location

Chromosome: 21
Locus: NM_006272.3
Locus Location: N/A
Size: 1 bp
Located at: S100B
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Zhang X, Shah BN, Zhang W, Saraf SL, Nouraie M, Nekhai S, Machado RF, Gladwin MT, Gordeuk VR, S100B has pleiotropic effects on vaso-occlusive manifestations in sickle cell disease., Am. J. Hematol., 95(3), E62-E65, 2020 PubMed
Created on 2020-09-08 12:26:33, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.