IthaID: 3616



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS II-809 (-G) HGVS Name: HBB:c.316-42delG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCC [G/-] TTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCA (Strand: -)

Also known as:

Comments: Found in a pregnant Italian woman in compound heterozygosity with IVS-II-745 (C>G) [IthaID:214] with near normal hematological indices. The intronic 1-bp deletion was also identified in the fetus.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71848
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Vinciguerra M, Cannata M, Cassarà F, Passarello C, Leto F, Calvaruso G, Renda D, Maggio A, Giambona A, HBB: c.316-125A>G and HBB: c.316-42delC: Phenotypic Evaluations of Two Rare Changes in the Second Intron of the HBB Gene., Hemoglobin, 41(0), 234-238, 2017 PubMed
Created on 2020-08-14 09:41:31, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.