IthaID: 3605



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: 3'UTR +132 C>T HGVS Name: HBB:c.*132C>T
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCCTAATAAAAAACATTTATTTTCATTG [C/T] AATGATGTATTTAAATTATTTCTGAATAT (Strand: -)

Comments: The mutation is located in the 3' UTR of the β-globin gene. In heterozygous carriers, the mutation causes a silent phenotype with borderline to normal MCV and HbA2 levels, while in compound heterozygosity with severe β-thal mutations; it leads to a mild intermedia β-thal phenotype.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72150
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai, Turkish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bilgen T, Clark OA, Ozturk Z, Akif Yesilipek M, Keser I, Two novel mutations in the 3' untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia., Int J Lab Hematol, 35(1), 26-30, 2013 PubMed
  2. Sripusanapan A, Phusua A, Fanhchaksai K, Charoenkwan P, Compound heterozygosity of a silent beta-thalassemia mutation at the 3'-untranslated region (HBB: c.*132 C>T) and beta-zero thalassemia results in thalassemia intermedia., Pediatr Blood Cancer, 67(4), e28157, 2020 PubMed
Created on 2020-07-16 10:43:03, Last reviewed on 2023-03-21 10:17:51 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.