IthaID: 3605
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | 3'UTR +132 C>T | HGVS Name: | HBB:c.*132C>T |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCCTAATAAAAAACATTTATTTTCATTG [C/T] AATGATGTATTTAAATTATTTCTGAATAT (Strand: -)
Comments: The mutation is located in the 3' UTR of the β-globin gene. In heterozygous carriers, the mutation causes a silent phenotype with borderline to normal MCV and HbA2 levels, while in compound heterozygosity with severe β-thal mutations; it leads to a mild intermedia β-thal phenotype.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β++ (silent) |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72150 |
Size: | 1 bp |
Located at: | β |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Thai, Turkish |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Bilgen T, Clark OA, Ozturk Z, Akif Yesilipek M, Keser I, Two novel mutations in the 3' untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia., Int J Lab Hematol, 35(1), 26-30, 2013 PubMed
- Sripusanapan A, Phusua A, Fanhchaksai K, Charoenkwan P, Compound heterozygosity of a silent beta-thalassemia mutation at the 3'-untranslated region (HBB: c.*132 C>T) and beta-zero thalassemia results in thalassemia intermedia., Pediatr Blood Cancer, 67(4), e28157, 2020 PubMed
Created on 2020-07-16 10:43:03,
Last reviewed on 2023-03-21 10:17:51 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.