IthaID: 3591



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs2963155 HGVS Name: NG_009062.1:g.64074T>C

Context nucleotide sequence:
TTAGAGAGAAGGAACGTGGACATA [T>C] AGAGGTAGCTCTAGATGGAGAAGGG (Strand: -)

Also known as:

Comments: The GG and GA genotypes associated with increased health care utilization for acute pain in an African-American cohort with sickle cell disease. No association with chronic pain as deduced by Composite Pain Index (CPI). Though there is a strong linkage disequilibrium among the three NR3C1 variants (rs33389, rs2963155 and rs9324918), they do not form a haploblock.

External Links

Location

Chromosome: 5
Locus: NG_009062.1
Locus Location: 64074
Size: 1 bp
Located at: NR3C1
Specific Location: Intron 2

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pain [HP:0012531]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Jhun EH, Sadhu N, Yao Y, He Y, Molokie RE, Wilkie DJ, Wang ZJ, Glucocorticoid receptor single nucleotide polymorphisms are associated with acute crisis pain in sickle cell disease., Pharmacogenomics, 19(13), 1003-1011, 2018 PubMed
Created on 2020-05-19 12:27:55, Last reviewed on 2020-05-19 12:31:36 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.