IthaID: 3589
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 62-65 (-12bp) | HGVS Name: | HBB:c.187_198delGCTCATGGCAAG |
Hb Name: | N/A | Protein Info: | p.62_65delAHGK |
Context nucleotide sequence:
ACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG [-/GCTCATGGCAAG] AAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCT (Strand: -)
Also known as:
Comments: Found in a heterozygote 3-years old boy with hemolytic anaemia since birth, elevated levels of HbF and HbA2 and target cells in the blood smear. The 12bp in frame deletion leading to a deletion of four amino acids. Patient also carries a mutation in PIEZO1 (c.5195C>T). Whether the clinical picture of the patient is caused by a strong modifying effect of the new mutation in PIEZO1 or is combined effect of two strongly deleterious mutations of PIEZO1 and β-globin gene is unclear.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | Unclear |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70911 |
Size: | 12 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Polish |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Maciak K, Adamowicz-Salach A, Siwicka A, Poznanski J, Urasinski T, Plochocka D, Gora M, Burzynska B, Hereditary xerocytosis - spectrum and clinical manifestations of variants in the PIEZO1 gene, including co-occurrence with a novel β-globin mutation., Blood Cells Mol. Dis., 80(0), 102378, 2020 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-05-18 14:23:17 | The IthaGenes Curation Team | Created |
2 | 2020-05-20 11:26:34 | The IthaGenes Curation Team | Reviewed. Common name corrected. |
3 | 2020-05-22 11:24:18 | The IthaGenes Curation Team | Reviewed. Comment edit. |
4 | 2020-05-22 11:27:20 | The IthaGenes Curation Team | Reviewed. Publication added. |
5 | 2020-05-22 12:14:31 | The IthaGenes Curation Team | Reviewed. Publication added |
6 | 2020-06-11 18:56:01 | The IthaGenes Curation Team | Reviewed. Reference added. |
7 | 2020-06-11 18:58:33 | The IthaGenes Curation Team | Reviewed. Reference added. |
8 | 2020-06-11 18:59:00 | The IthaGenes Curation Team | Reviewed. Reference added. |
9 | 2020-06-11 19:00:14 | The IthaGenes Curation Team | Reviewed. Reference added. |
10 | 2020-06-11 19:00:58 | The IthaGenes Curation Team | Reviewed. Reference added. |
11 | 2020-06-11 19:01:28 | The IthaGenes Curation Team | Reviewed. Reference added. |
12 | 2020-07-15 11:04:34 | The IthaGenes Curation Team | Reviewed. Edits. |
13 | 2020-08-10 12:29:32 | The IthaGenes Curation Team | Reviewed. Reference added. |