IthaID: 3576

Context nucleotide sequence:
AACTTCAGGGTGAGTCTATGGGAC [G>C] CTTGATGTTTTCTTTCCCCTTCTTTTC (Strand: -)

Also known as: IVS II-16 G>C, HBB:c.315+16G>C

Comments: Variant identifies the polymorphic site AvaII in the beta-globin gene cluster that is used in the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian). It has been included on SNP chips to infer β-haplotypes [PMID: 18829352, 28800727, 23606168] and to develop a fetal haplotype phase strategy for the NIPD of beta-thalassaemia [PMID: 22896714]. It has been found in a heterozygous and homozygous state in a normal healthy population from urban eastern India [PMID: 24099628], as well as in Mohajir families from Pakistan [PMID: 22392582].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Liu L, Muralidhar S, Singh M, Sylvan C, Kalra IS, Quinn CT, Onyekwere OC, Pace BS, High-density SNP genotyping to define beta-globin locus haplotypes., Blood Cells Mol. Dis. , 42(1), 16-24, 2009 PubMed
2. Lam KW, Jiang P, Liao GJ, Chan KC, Leung TY, Chiu RW, Lo YM, Noninvasive prenatal diagnosis of monogenic diseases by targeted massively parallel sequencing of maternal plasma: application to β-thalassemia., Clin. Chem. , 58(10), 1467-75, 2012 PubMed
3. Moatter T, Kausar T, Aban M, Ghani S, Pal JA, Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population., Int. J. Hematol. , 95(4), 394-8, 2012 PubMed
4. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013 PubMed
5. Sahoo SS, Biswal S, Dixit M, Distinctive mutation spectrum of the HBB gene in an urban eastern Indian population., Hemoglobin , 38(1), 33-8, 2014 PubMed
6. Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017 PubMed