IthaID: 3574



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: rs28440105 HGVS Name: NG_000007.3:g.49047T>G | NG_000007.3:g.49047T>A

Context nucleotide sequence:
ACATAGGCTTGATTCTGGGTGGAAGCT [T/G/A] GGTGTGTAGTTATCTGGAGGCCAGGCT (Strand: -)

Also known as:

Comments: Variant identifies the polymorphic site HindIII in the beta-globin gene cluster, which is used in the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 49047
Size: 1 bp
Located at:
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017 PubMed
Created on 2020-03-10 15:42:09, Last reviewed on 2020-04-22 13:33:26 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.