IthaID: 3573
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs3834466 | HGVS Name: | NG_000007.3:g.27282dup |
Context nucleotide sequence:
TTTCCTTGGCCCTGTTTTTGTCA [-/A] CTGTCACCACCTTTAAGGCAAA (Strand: -)
Also known as:
Comments: Variant 2KB upstream of the HBE1 gene. It identifies the polymorphic site HincII in the beta-globin gene cluster, which is used in the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 27282 |
Size: | 1 bp |
Located at: | β |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017 PubMed
Created on 2020-03-10 15:30:25,
Last reviewed on 2020-04-22 13:05:10 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-03-10 15:30:25 | The IthaGenes Curation Team | Created |
2 | 2020-03-10 15:34:30 | The IthaGenes Curation Team | Reviewed. Reference added. |
3 | 2020-04-22 13:05:10 | The IthaGenes Curation Team | Reviewed. Functionality corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07