IthaID: 3572



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 90‐92 (-8bp): (‐AGCTTCGG) HGVS Name: HBA2:c.272_279delAGCTTCGG
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTGAGCGACCTGCACGCGCACA [-/AGCTTCGG] GTGGACCCGGTCAACTTCAAG (Strand: +)

Comments: Reported in trans with the southeast Asian type deletion α-thalassemia (--SEA) in two Chinese probands affected with hemoglobin H disease. Also found in a heterozygous and a homozygous state in family members of these probands. The deletion was detected by NGS and CE, and confirmed by gap-PCR and sequencing analysis.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34164
Size: 8 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Li Y, Liang L, Tian M, Qin T, Wu X, Detection of Hb H disease caused by a novel mutation and -- deletion using capillary electrophoresis., J. Clin. Lab. Anal., 33(7), e22949, 2019 PubMed
  2. Lyu J, Mo X, Li X, [Genetic testing and pedigree analysis for a case with intermediate α-thalassemia[--/αα]]., Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 39(12), 1398-1401, 2022 PubMed
Created on 2020-02-19 17:37:49, Last reviewed on 2023-01-11 14:49:36 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.