IthaID: 3572
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 90‐93 (-8bp): (‐AGCTTCGG) | HGVS Name: | HBA2:c.272_279delAGCTTCGG |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CTGAGCGACCTGCACGCGCACA [-/AGCTTCGG] GTGGACCCGGTCAACTTCAAG (Strand: +)
Also known as:
Comments: Reported in three members of a Chinese family. Initially found together with the --SEA deletion in a 2-year-old boy presenting with Hb H disease (Hb 87 g/L, MCV 61.1 fL, MCH 16.4 pg, Hb H 14.3%, Hb Bart's 2.4%). The father was homozygous for this deletion. The mother did not carry this deletion but her fetus, a second baby, had compound heterozygous mutations as the proband. Detected by CE and confirmed by gap-PCR and sequencing analysis.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34164 |
Size: | 8 bp |
Located at: | α2 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Li Y, Liang L, Tian M, Qin T, Wu X, Detection of Hb H disease caused by a novel mutation and -- deletion using capillary electrophoresis., J. Clin. Lab. Anal., 33(7), e22949, 2019 PubMed
Created on 2020-02-19 17:37:49,
Last reviewed on 2020-02-19 17:41:44 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-02-19 17:37:49 | The IthaGenes Curation Team | Created |
2 | 2020-02-19 17:41:44 | The IthaGenes Curation Team | Reviewed. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-08-12 10:07:42