IthaID: 3572

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	N/A
Common Name:	CD 90‐93 (-8bp): (‐AGCTTCGG)	HGVS Name:	HBA2:c.272_279delAGCTTCGG
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
CTGAGCGACCTGCACGCGCACA [-/AGCTTCGG] GTGGACCCGGTCAACTTCAAG (Strand: +)

Also known as:

Comments: Reported in three members of a Chinese family. Initially found together with the --SEA deletion in a 2-year-old boy presenting with Hb H disease (Hb 87 g/L, MCV 61.1 fL, MCH 16.4 pg, Hb H 14.3%, Hb Bart's 2.4%). The father was homozygous for this deletion. The mother did not carry this deletion but her fetus, a second baby, had compound heterozygous mutations as the proband. Detected by CE and confirmed by gap-PCR and sequencing analysis.

External Links

No available links

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	α⁺
Associated Phenotypes:	Haemolytic anaemia [HP:0001878]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	34164
Size:	8 bp
Located at:	α2
Specific Location:	Exon 2

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Chinese
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Li Y, Liang L, Tian M, Qin T, Wu X, Detection of Hb H disease caused by a novel mutation and -- deletion using capillary electrophoresis., J. Clin. Lab. Anal., 33(7), e22949, 2019 PubMed

Created on 2020-02-19 17:37:49, Last reviewed on 2020-02-19 17:41:44 (Show full history)

A/A	Date	Curator(s)	Comments
1	2020-02-19 17:37:49	The IthaGenes Curation Team	Created
2	2020-02-19 17:41:44	The IthaGenes Curation Team	Reviewed. Reference added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.