IthaID: 3569



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 89-93 (-13bp): (-CACAAGCTTCGGG) HGVS Name: HBA2:c.268_280delCACAAGCTTCGGG
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTGTCCGCCCTGAGCGACCTGCACGCG [-/CACAAGCTTCGGG] TGGACCCGGTCAACTTCAAGGTGAGC (Strand: +)

Comments: Reported in a proband presenting with persistent microcytosis and hypochromia. The deletion of 13 bp creates a frameshift in the reading frame with a premature stop codon at codon 97 (TAA). Codons 89-93 constitute the region between FG helices, which affects the α1β1 interaction and the maintenance of the tertiary structure.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34160
Size: 13 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Moroccan
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Ropero P, Arbeteta J, Nieto JM, González FA, González B, Villegas A, Benavente C, Nondeletional α-Thalassemia: Two New Mutations on the α2 Gene., Hemoglobin, 2020 PubMed
Created on 2020-02-03 11:52:59, Last reviewed on 2022-09-20 09:29:28 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.