IthaID: 3569
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 89-93 (-13bp): (-CACAAGCTTCGGG) | HGVS Name: | HBA2:c.268_280delCACAAGCTTCGGG |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTGTCCGCCCTGAGCGACCTGCACGCG [-/CACAAGCTTCGGG] TGGACCCGGTCAACTTCAAGGTGAGC (Strand: +)
Comments: Reported in a proband presenting with persistent microcytosis and hypochromia. The deletion of 13 bp creates a frameshift in the reading frame with a premature stop codon at codon 97 (TAA). Codons 89-93 constitute the region between FG helices, which affects the α1β1 interaction and the maintenance of the tertiary structure.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34160 |
Size: | 13 bp |
Located at: | α2 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Moroccan |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Ropero P, Arbeteta J, Nieto JM, González FA, González B, Villegas A, Benavente C, Nondeletional α-Thalassemia: Two New Mutations on the α2 Gene., Hemoglobin, 2020 PubMed
Created on 2020-02-03 11:52:59,
Last reviewed on 2022-09-20 09:29:28 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.