IthaID: 3558



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-821 (A>C) HGVS Name: HBB:c.316-30A>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AAGCTAGGCCCTTTTGCTAATC [A>C] TGTTCATACCTCTTATCTTCCT (Strand: -)

Also known as:

Comments: Variant was found in a Kurdish family. Three siblings were carriers, whereas the father and one sibling had no mutations in the β-globin gene. No maternal information was provided. All carriers presented with low haematological indices and abnormal HbA2 (around 5%). Bioinformatics analysis showed that this variant may influence normal splicing process.

External Links

No available links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71860
Size: 1 bp
Located at: β
Specific Location: Intron 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Kurdish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Azimi A, Nejati P, Tahmasebi S, Alimoradi S, Alibakhshi R, Characterization of the IVS-II-821 (A>C) (: c.316-30A>C) Mutation in a β-Thalassemia Phenotype in Iran., Hemoglobin, 43(1), 23-26, 2019 PubMed
Created on 2020-01-17 11:28:40, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.