IthaID: 3558



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-821 (A>C) HGVS Name: HBB:c.316-30A>C
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AAGCTAGGCCCTTTTGCTAATC [A>C] TGTTCATACCTCTTATCTTCCT (Strand: -)

Comments: There are conflicting interpretations of pathogenicity for this variant. Data from contributors shows that carriers presented with normal haematological indices and also that co-inheritance of IVS II-821 (A>C) with α-variants does not cause more severe clinical symptoms than expected. In contrast, the variant was found in a Kurdish family [PMID: 31146650] where three siblings were carriers and presented with low haematological indices and abnormal HbA2 (around 5%). The father and one sibling had no mutations in the β-globin gene. No maternal information was provided. Bioinformatics analysis showed that this variant may influence normal splicing process.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71860
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Kurdish, Cypriot
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Azimi A, Nejati P, Tahmasebi S, Alimoradi S, Alibakhshi R, Characterization of the IVS-II-821 (A>C) (: c.316-30A>C) Mutation in a β-Thalassemia Phenotype in Iran., Hemoglobin, 43(1), 23-26, 2019 PubMed
Created on 2020-01-17 11:28:40, Last reviewed on 2022-11-15 13:16:10 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.