IthaID: 3555



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 124 (+C) HGVS Name: HBB:c.374dup
Hb Name: N/A Protein Info: p.Pro126Thrfs*15

Context nucleotide sequence:
CCCATCACTTTGGCAAAGAATTCACCC [-/C] ACCAGTGCAGGCTGCCTATCAGAAAG (Strand: -)

Also known as:

Comments: Single nucleotide duplication (+C) generating a frameshift that leads to shortening of the β-globin chain with a stop codon at codon 139 (TAA). Reported in a patient with severe microcytic and hypochromic anaemia.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71948
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Algerian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Abdaoui W, Benouareth DE, Djenouni A, Renoux C, Grifi F, Gouri A, Athamnia F, Benalioua M, Joly P, Genetic Background of β-Thalassemia in Northeast Algeria with Assessment of the Thalassemia Severity Score and Description of a new β-Thalassemia Frameshift Mutation (: c.374dup; p.Pro126Thrfs*15)., Hemoglobin, 43(0), 223-228, 2019 PubMed
Created on 2020-01-10 08:59:43, Last reviewed on 2020-07-01 11:47:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.