IthaID: 3548



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs933224 HGVS Name: NG_011884.2:g.23061A>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTTACAAAGGTTAAAGTCACTTTCA [A>G] GTTATTGCAACAAAAGTCTCTCAAT (Strand: -)

Comments: SNP associated with glomerular filtration rate in individuals with sickle cell disease (SCD) acquired from the Duke University Medical Center, the University of North Carolina at Chapel Hill, the East Carolina University and the Emory University Sickle Cell Centers.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Abnormal GFR [HP:0012212]

Location

Chromosome: 22
Locus: NG_011884.2
Locus Location: 23061
Size: 1 bp
Located at: MYH9
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: non-Hispanic African-American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Ashley-Koch AE, Okocha EC, Garrett ME, Soldano K, De Castro LM, Jonassaint JC, Orringer EP, Eckman JR, Telen MJ, MYH9 and APOL1 are both associated with sickle cell disease nephropathy., Br. J. Haematol. , 155(3), 386-94, 2011 PubMed
Created on 2019-12-18 12:42:40, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.