IthaID: 3546



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 130 TAT>-AT HGVS Name: HBD:c.391delT
Hb Name: Hb A2-Gaslini 1 Protein Info: p.Tyr131Ilefs?

Context nucleotide sequence:
AATTCACCCCACAAATGCAGGCTGCC [T/-] ATCAGAAGGTGGTGGCTGGTGTGGCT (Strand: -)

Also known as:

Comments: Single nucleotide deletion (-T) generating a frameshift with elongation of the δ-globin chain to 212 amino acids. Found in a heterozygous state. Presents with normochromic normocytic red cell morphology, HbA2 level 1.6% and HbF level 0.6%. No visible peak on HPLC, hence presumed to be unstable.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: δ-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 64599
Size: 1 bp
Located at: δ
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Mahmud N, Maffei M, Mogni M, Forni GL, Pinto VM, Barberio G, Ungari S, Maffè A, Curcio C, Zanolli F, Paventa R, Carta M, Caleffi A, Mercadanti M, Maoggi S, Ivaldi G, Coviello D, Hemoglobin A and Heterogeneous Diagnostic Relevance Observed in Eight New Variants of the Delta Globin Gene., Genes (Basel), 12(11), 0, 2021 PubMed

Microattributions

A/AContributor(s)DateComments
1Coviello, Domenico2019-12-12First report.
2Maffei, Massimo2019-12-12First report.
Created on 2019-12-16 16:26:15, Last reviewed on 2023-03-13 15:17:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.