IthaID: 3536
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1479076497 | HGVS Name: | NC_000010.11:g.70151278_70151284del |
Context nucleotide sequence:
CATACCAAAAAAAAAAAAAAAAAA [ -/AAAAAAA] CCTGGAAAAGCTACAGATGTTAACC (Strand: +)
Also known as:
Comments: Variant showed significant association with total haemoglobin levels after hydroxyurea treatment in sickle cell disease patients. Source: Blood (2019) 134 (Supplement_1): 987; doi.org/10.1182/blood-2019-124965.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Response to hydroxyurea |
Location
| Chromosome: | 10 |
|---|---|
| Locus: | NM_001142648.2 |
| Locus Location: | N/A |
| Size: | 7 bp |
| Located at: | SAR1A |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | N/A |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Created on 2019-12-12 13:11:16,
Last reviewed on 2021-09-29 15:41:31 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2019-12-12 13:11:16 | The IthaGenes Curation Team | Created |
| 2 | 2019-12-12 15:03:54 | The IthaGenes Curation Team | Reviewed. HGVS name, Location, and Context sequence corrected. |
| 3 | 2019-12-12 15:39:21 | The IthaGenes Curation Team | Reviewed. Locus added. |
| 4 | 2021-09-29 15:41:31 | The IthaGenes Curation Team | Reviewed. dbSNP link removed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07