IthaID: 3534



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs55890525 HGVS Name: NC_000010.11:g.70171015C>A

Context nucleotide sequence:
CGCGATCTCGGCTCACTGCAACCTCCA [C>A] CTCCCGGATTCAAGCGATTCTCATACC (Strand: +)

Also known as:

Comments: SNP is located within 2KB 5' of SAR1A gene. SNP is associated with a higher percent of HbF with hydroxyurea treatment in African Americans with sickle cell disease acquired from the Sickle Cell Pulmonary Hypertension Screening Study (n=176). Note: Published SNP position 'chr10:71600777 (hg18)' is remapped on the GRCh38.p13 genome assembly.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Location

Chromosome: 10
Locus: NM_001142648.2
Locus Location: N/A
Size: 1 bp
Located at: SAR1A
Specific Location: N/A 0

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African-American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Kumkhaek C, Taylor JG, Zhu J, Hoppe C, Kato GJ, Rodgers GP, Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia., Br. J. Haematol. , 141(2), 254-9, 2008 PubMed
Created on 2019-12-12 12:18:21, Last reviewed on 2019-12-12 15:38:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.