IthaID: 3513
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 8 AAG>AA- | HGVS Name: | HBB:c.27delG |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GGTGCATCTGACTCCTGAGGAGAA [G/-] TCTGCCGTTACTGCCCTGTGGGGCA (Strand: -)
Also known as:
Comments: Found as a de novo mutation in a compound heterozygous state with Hb E in a transfusion-dependent 1-year-old child presenting with β-thalassaemia major complications. The mother was a heterozygous carrier of Hb E and the father was evaluated as normal. Paternity was confirmed. The loss of a nt G from codon 8 changes the reading frame with a stop codon at codon 18 resulting in a premature termination of translation.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70621 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | Bangladeshi |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Hasan KN, Sufian A, Mazumder AK, Khaleque MA, Rahman M, Akhteruzzaman S, A Novel Pathogenic β-Thalassemia Mutation Identified at Codon 8 (: c.27delG) in a Bangladeshi Family Acquired ., Hemoglobin, 43(3), 162-165, 2019 PubMed
Created on 2019-12-03 09:15:28,
Last reviewed on 2019-12-03 16:37:50 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2019-12-03 09:15:28 | The IthaGenes Curation Team | Created |
2 | 2019-12-03 16:37:50 | The IthaGenes Curation Team | Reviewed. Allele phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-12-03 11:48:06