IthaID: 3444



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 147 TAA>TCA [Stop>Ser] HGVS Name: HBB:c.443A>C
Hb Name: Hb Kanagawa Protein Info: N/A

Context nucleotide sequence:
CTAATGCCCTGGCCCACAAGTATCACT [A>C] AGCTCGCTTTCTTGCTGTCCAATT (Strand: -)

Also known as:

Comments: Reported as a de novo mutation in a two-month-old patient, initially diagnosed with congenital dyserythropoietic anaemia. This mutation results in a stop-codon substitution to a serine residue and an increase of 21 amino-acids in the beta-globin chain. Leads to a dominant beta-thalassemia state according to this case report.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72017
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Sugiyama M, Hamanoue S, Nagai JI, Tsurusaki Y, Kurosawa K, Tanaka M, Tanaka Y, Goto H, Hemoglobin beta Kanagawa [c.443A>C; p.(Ter148Serext*21)]: A novel β-globin gene mutation causing dominantly inherited β-thalassemia., Pediatr Blood Cancer, 66(9), e27871, 2019 PubMed
Created on 2019-09-03 12:49:58, Last reviewed on 2023-07-03 16:00:59 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.