IthaID: 3443



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: Cap +1570 (T>C) HGVS Name: HBB:c*96T>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
ATTATGAAGGGCCTTGAGCATC [T>C] GGATTCTGCCTAATAAAAAACA (Strand: -)

Comments: The mutation is located 12 nucleotides upstream of the polyadenylation signal in the 3' UTR of the β-globin gene. In heterozygous carriers, the mutation causes a silent phenotype, while in compound heterozygosity with severe beta-thal mutations, it leads to a beta-thal intermedia state.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72114
Size: 1 bp
Located at: β
Specific Location: 3'UTR 0

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Czech, Greek, Turkish, Italian
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Unknown

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Divoky V, Baysal E, Oner R, Cürük MA, Walker EL, Indrak K, Huisman TH, The T-->C mutation at position +96 of the untranslated region 3' to the terminating codon of the beta-globin gene is a rare polymorphism that does not cause a beta-thalassemia as previously ascribed., Hum. Genet., 93(1), 77-8, 1994 PubMed
  2. Bilgen T, Canatan D, Arıkan Y, Yeşilipek A, Keser İ, The effect of HBB: c.*+96T>C (3'UTR +1570 T>C) on the mild b-thalassemia intermedia phenotype., Turk J Haematol, 28(3), 219-22, 2011 PubMed
  3. Vinciguerra M, Passarello C, Cassarà F, Leto F, Cannata M, Calvaruso G, Di Maggio R, Renda D, Maggio A, Giambona A, Co-heredity of silent CAP + 1570 T>C (HBB:c*96T>C) defect and severe β-thal mutation: a cause of mild β-thalassemia intermedia., Int J Lab Hematol, 38(1), 17-26, 2016 PubMed
  4. Theodoridou S, Vyzantiadis TA, Vlachaki E, Compound Heterozygosity for Silent Cap +1570 (T>C) (HBB: c*96T>C), Codon 39 (C>T) (HBB: c.118C>T) and the Presence of ααα/αα in Greece. A Case Presentation., Hemoglobin, 42(3), 194-195, 2018 PubMed
Created on 2019-09-03 12:13:12, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.