IthaID: 3441



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 59 AAG>A-G HGVS Name: HBD:c.179delA
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCTGATGCTGTTATGGGCAACCCTA [A/-] GGTGAAGGCTCATGGCAAGAAGGTG (Strand: -)

Comments: The deletion leads to a premature termination in codon 60. Reported in combination with Hb Knossos, presenting with normal or borderline red blood cell indices and low Hb A2 levels. Also reported in a patient with Hb Knossos/codon 5 [−CT] and beta thalassaemia intermedia.

External Links

No available links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63489
Size: 1 bp
Located at: δ
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:δ0
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Syrian, Egyptian, Tunisian, Libyan
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Unknown

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Olds RJ, Sura T, Jackson B, Wonke B, Hoffbrand AV, Thein SL, A novel delta 0 mutation in cis with Hb Knossos: a study of different genetic interactions in three Egyptian families., British journal of haematology, 78(3), 430-6, 1991 PubMed
  2. Sahli CA, Bibi A, Ouali F, Siala H, Fredj SH, Othmani R, Ouenniche F, Cheour M, Fitouri Z, Becher SB, Messaoud T, δ0-Thalassemia in cis of βKnossos globin gene: first homozygous description in thalassemia intermedia Libyans and first combination with codon 39 (C→T) in thalassemia intermedia Tunisian patients., Clin. Chem. Lab. Med., 50(10), 1743-8, 2012 PubMed
  3. Moassas F, Nweder MS, Murad H, Hb Knossos (HBB: c.82G > T), β-globin CD 5 (-CT) (HBB: c.17_18delCT) and δ-globin CD 59 (-a) (HBD: c.179delA) mutations in a Syrian patient with β-thalassemia intermedia., BMC Pediatr, 19(1), 61, 2019 PubMed
Created on 2019-07-29 14:43:11, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.