IthaID: 3437



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 2 CAT>-AT HGVS Name: HBB:c.7delC
Hb Name: Hb Bundelkhand Protein Info: N/A

Context nucleotide sequence:
CACTAGCAACCTCAAACAGACACCATGGTG [C>T] ATCTGACTCCTGAGGAGAAGTCTGCCGTTA (Strand: -)

Comments: Reported in a heterozygous state with mild anaemia, as well as in co-inheritance with a β+ mutation with severe anaemia. This deletion is predicted to result in the shifting of reading frame and hence premature termination of the polypeptide after codon 3. The abnormal mRNA is presumably degraded before traduction by the NMD mechanism.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70601
Size: 1 bp
Located at: β
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β0
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Indian
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Unknown

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2019-06-24 15:26:39, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.