IthaID: 3431



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Benign / Likely Benign
Common Name: IVS I-38 C>T HGVS Name: HBA1:c.95+38C>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCCCTGCTCCGACCCGGGCTCCTCG [C>T] CCGCCCGGACCCACAGGCCACCCTC (Strand: +)

Also known as:

Comments: Detected together with CD 19 (-G) [ithaID=2465] in an Iranian subject with elevated Hb Bart's levels. The effect of this mutation on HBA1 gene expression is unclear as no regulatory sites seem to be involved. No mRNA analysis was performed to determine whether this mutation affects the α-gene expression or is merely a polymorphism.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:Unclear
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37712
Size: 1 bp
Located at: α1
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Harteveld CL, Yavarian M, Zorai A, Quakkelaar ED, van Delft P, Giordano PC, Molecular spectrum of alpha-thalassemia in the Iranian population of Hormozgan: three novel point mutation defects., American journal of hematology, 74(2), 99-103, 2003 PubMed
Created on 2019-05-29 16:49:10, Last reviewed on 2019-05-29 17:15:37 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.