IthaID: 3416



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs12477097 HGVS Name: NG_011968.1:g.87237T>G

Context nucleotide sequence:
CTCTGCTTCCCCTGCAGAATTAGACAGCTA [A>C] AAACATTTCTATCAGCCTAAGAAGCTATTT (Strand: +)

Also known as:

Comments: SNP associated with HbF levels (positive effect) in Chinese β-thalassaemia heterozygotes [PMID: 21385855]. SNP was found to have a significant effect on HbF levels in a meta-analysis of many GWAS with a total of 2040 sickle cell anaemia patients from 7 cohorts (e.g., CSSCD, MSH, PUSH, Walk-PHaSST and SIT) [PMID: 22936743].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 87237
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese, African-American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011 PubMed
  2. Bae HT, Baldwin CT, Sebastiani P, Telen MJ, Ashley-Koch A, Garrett M, Hooper WC, Bean CJ, Debaun MR, Arking DE, Bhatnagar P, Casella JF, Keefer JR, Barron-Casella E, Gordeuk V, Kato GJ, Minniti C, Taylor J, Campbell A, Luchtman-Jones L, Hoppe C, Gladwin MT, Zhang Y, Steinberg MH, Meta-analysis of 2040 sickle cell anemia patients: BCL11A and HBS1L-MYB are the major modifiers of HbF in African Americans., Blood , 120(9), 1961-2, 2012 PubMed
Created on 2019-05-23 17:08:26, Last reviewed on 2019-05-24 09:44:27 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.