IthaID: 3411
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2855121 | HGVS Name: | NG_000007.3:g.41555G>A |
Context nucleotide sequence:
TATAATTCCTATCAACCTGATA [G>A] GTTAGGGGAAGGTAGAGCTCTCC (Strand: -)
Also known as:
Comments: HBG2 upstream variant. rs2855121 (A) associated with elevated HbF levels in African Americans with sickle cell anaemia (CSSCD cohort). Associated with disease severity in Thai individuals with β0-thalassaemia/HbE.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Severity [HP:0012824] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 41555 |
| Size: | 1 bp |
| Located at: | Gγ |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010 PubMed
- Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010 PubMed
Created on 2019-05-23 13:48:58,
Last reviewed on 2021-07-12 14:53:59 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2019-05-23 13:48:58 | The IthaGenes Curation Team | Created |
| 2 | 2019-05-24 09:47:59 | The IthaGenes Curation Team | Reviewed. Inheritance mode corrected. |
| 3 | 2021-07-12 14:53:59 | The IthaGenes Curation Team | Reviewed. Reference and Phenotype added. Comment and Ethnicity updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-10-29 15:59:14