IthaID: 3410

Context nucleotide sequence:
CTCTCAGTCAATTCGATTCTACTACTGACA [T>C] TTATCAACATGGTGGGTGTGATATCTTTTA (Strand: +)

Also known as: rs11154792

Comments: SNP is located within an enhancer-like regulatory sequence 71 kb upstream of the MYB transcriptional start site (-71 LDB1 complex binding site) adjacent to a GATA1 motif. The rs9494142 C allele disrupts a stretch of 3 A/T residues adjacent to the “TATC” core GATA1 motif, affecting long-range MYB regulation [PMID: 24614105]. SNP associated with elevated HbF levels in African-Americans (CSSCD cohort) [PMID: 21057501] and Cameroonians [PMID: 24667352] with sickle-cell disease (SCD), as well as in Chinese cohorts with β-thalassaemia [PMID: 18697826, 22023465, 27835778, 28361591]. An association with a HbF level > 40% was detected in β-thalassaemia patients from the Eastern Province of Saudi-Arabia [PMID: 28280727]. The association with HbF levels was not replicated in healthy Chinese subjects [PMID: 18697826] or in SCD cohorts of African-Caribbean (Jamaican, Trinidanian) or West African (Nigerian, Ghanaian, Sierra Leonean) descent [PMID: 21068433]. Also, SNP associated with F cell levels in families of Northern European ancestry (Twins U.K. Adult Twin Registry) [PMID: 17592125]. The association signal varied across healthy African-descended populations from Jamaica and was detected in European expatriates and the Afro-German cohort. The association with F cell numbers was not replicated in healthy Afro-Caribbean subjects or in patients with sickle cell anaemia of African origin [PMID: 19148297].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Thein SL, Menzel S, Peng X, Best S, Jiang J, Close J, Silver N, Gerovasilli A, Ping C, Yamaguchi M, Wahlberg K, Ulug P, Spector TD, Garner C, Matsuda F, Farrall M, Lathrop M, Intergenic variants of HBS1L-MYB are responsible for a major quantitative trait locus on chromosome 6q23 influencing fetal hemoglobin levels in adults., Proc. Natl. Acad. Sci. U.S.A. , 104(27), 11346-51, 2007 PubMed
2. So CC, Song YQ, Tsang ST, Tang LF, Chan AY, Ma ES, Chan LC, The HBS1L-MYB intergenic region on chromosome 6q23 is a quantitative trait locus controlling fetal haemoglobin level in carriers of beta-thalassaemia., J. Med. Genet. , 45(11), 745-51, 2008 PubMed
3. Creary LE, Ulug P, Menzel S, McKenzie CA, Hanchard NA, Taylor V, Farrall M, Forrester TE, Thein SL, Genetic variation on chromosome 6 influences F cell levels in healthy individuals of African descent and HbF levels in sickle cell patients., PLoS ONE, 4(1), e4218, 2009 PubMed
4. Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010 PubMed
5. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011 PubMed
6. Makani J, Menzel S, Nkya S, Cox SE, Drasar E, Soka D, Komba AN, Mgaya J, Rooks H, Vasavda N, Fegan G, Newton CR, Farrall M, Thein SL, Genetics of fetal hemoglobin in Tanzanian and British patients with sickle cell anemia., Blood, 117(4), 1390-2, 2011 PubMed
7. Stadhouders R, Aktuna S, Thongjuea S, Aghajanirefah A, Pourfarzad F, van Ijcken W, Lenhard B, Rooks H, Best S, Menzel S, Grosveld F, Thein SL, Soler E, HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers., J. Clin. Invest. , 124(4), 1699-710, 2014 PubMed
8. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014 PubMed
9. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016 PubMed
10. Lai Y, Chen Y, Chen B, Zheng H, Yi S, Li G, Wei H, He S, Zheng C, Genetic Variants at BCL11A and HBS1L-MYB loci Influence Hb F Levels in Chinese Zhuang β-Thalassemia Intermedia Patients., Hemoglobin, 40(6), 405-410, 2016 PubMed
11. Cyrus C, Vatte C, Borgio JF, Al-Rubaish A, Chathoth S, Nasserullah ZA, Jarrash SA, Sulaiman A, Qutub H, Alsaleem H, Alzahrani AJ, Steinberg MH, Ali AK, Existence of HbF Enhancer Haplotypes at Intergenic Region in Transfusion-Dependent Saudi -Thalassemia Patients., Biomed Res Int, 2017(0), 1972429, 2017 PubMed