IthaID: 341



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: Init CD ATG>GTG HGVS Name: HBA1:c.1A>G
Hb Name: N/A Protein Info: α1 nt 38 A>G

Context nucleotide sequence:
CCCACAGACTCAGAGAGAACCCACC [A/G] TGGTGCTGTCTCCTGCCGACAAGAC (Strand: +)

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37580
Size: 1 bp
Located at: α1
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Initiation codon (Translation)
Ethnic Origin: Mediterranean, Sardinian
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Paglietti E, Galanello R, Moi P, Pirastu M, Cao A, Molecular pathology of haemoglobin H disease in Sardinians., Br. J. Haematol. , 63(3), 485-96, 1986 PubMed
  2. Moi P, Cash FE, Liebhaber SA, Cao A, Pirastu M, An initiation codon mutation (AUG----GUG) of the human alpha 1-globin gene. Structural characterization and evidence for a mild thalassemic phenotype., The Journal of clinical investigation, 80(5), 1416-21, 1987 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-08 17:04:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.