IthaID: 3405



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: CD 47-53 (-20bp): (-GACCTGAGCCACGGCTCTGC) HGVS Name: HBA2:c.142_161del
Hb Name: N/A Protein Info: α2 47 - 53 (-GACCTGAGCCACGGCTCTGC); modified C-terminal sequence
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTACTTCCCGCACTTC [GACCTGAGCCACGGCTCTGC/-] CCAGGTTAAGGGCCAC (Strand: +)

Comments: The 20 nt deletion creates a frameshift and a premature termination codon and would probably undergo nonsense-mediated decay, causing a thalassemic phenotype.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34034
Size: 20 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Norwegian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Grimholt RM, Fjeld B, Klingenberg O, Hemoglobinopathy gone astray-three novel forms of α-thalassemia in Norwegian patients characterized by quantitative real-time PCR and DNA sequencing., Scand J Clin Lab Invest, 2021 PubMed
Created on 2019-04-12 09:45:47, Last reviewed on 2022-07-12 12:01:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.