IthaID: 3343
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs743811 | HGVS Name: | NC_000022.10:g.35792974T>C |
Context nucleotide sequence:
TTTTACTAATAGGAGAATGGCTGAA [A/C/T] AATTTTTTCCTATCAATTGTCGAAC (Strand: +)
Also known as:
Comments: SNP associated with albuminuria, eGFR and chronic kidney disease stage in the University of Illinois SCD cohort (n=247), as well as with end-stage renal disease in the Walk-Treatment of Pulmonary Hypertension and Sickle cell Disease with Sildenafil Therapy cohort (n=540) [PMID: 26206798]. The 'C' allele associated with a decreased risk of albuminuria in a pediatric SCD cohort from Brazil [PMID: 32083326].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Abnormal GFR [HP:0012212] Albuminuria [HP:0012592] |
Location
Chromosome: | 22 |
---|---|
Locus: | NG_023030.1 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | HMOX1 |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Saraf SL, Zhang X, Shah B, Kanias T, Gudehithlu KP, Kittles R, Machado RF, Arruda JA, Gladwin MT, Singh AK, Gordeuk VR, Genetic variants and cell-free hemoglobin processing in sickle cell nephropathy., Haematologica , 100(10), 1275-84, 2015 PubMed
- Belisário AR, de Almeida JA, Mendes FG, da Silva DMM, Planes W, Rezende PV, Silva CM, Brito AC, Sales RR, Viana MB, Simões E Silva AC, Prevalence and risk factors for albuminuria and glomerular hyperfiltration in a large cohort of children with sickle cell anemia., Am. J. Hematol., 95(5), E125-E128, 2020 PubMed
Created on 2018-08-23 19:31:04,
Last reviewed on 2020-06-26 13:34:32 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2018-08-23 19:31:04 | The IthaGenes Curation Team | Created |
2 | 2020-06-26 13:34:32 | The IthaGenes Curation Team | Reviewed. Reference added, Comment updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45