IthaID: 3343



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs743811 HGVS Name: NC_000022.10:g.35792974T>C

Context nucleotide sequence:
TTTTACTAATAGGAGAATGGCTGAA [A/C/T] AATTTTTTCCTATCAATTGTCGAAC (Strand: +)

Comments: SNP associated with albuminuria, eGFR and chronic kidney disease stage in the University of Illinois SCD cohort (n=247), as well as with end-stage renal disease in the Walk-Treatment of Pulmonary Hypertension and Sickle cell Disease with Sildenafil Therapy cohort (n=540).

External Links

No available links

Location

Chromosome: 22
Locus: NG_023030.1
Locus Location: N/A
Size: 1 bp
Located at: HMOX1
Specific Location: N/A

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Glomerular filtration rate [HP:0012212]
Albuminuria [HP:0012592]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Saraf SL, Zhang X, Shah B, Kanias T, Gudehithlu KP, Kittles R, Machado RF, Arruda JA, Gladwin MT, Singh AK, Gordeuk VR, Genetic variants and cell-free hemoglobin processing in sickle cell nephropathy., Haematologica , 100(10), 1275-84, 2015 PubMed
Created on 2018-08-23 19:31:04, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.