IthaID: 3337



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs6920211 HGVS Name: NC_000006.12:g.135110180T>C

Context nucleotide sequence:
GGTTCCATTGAGACTGATGCTGCAT [C/T] GAATTCTGATGATACAGTTCGCTGC (Strand: +)

Also known as:

Comments: SNP is located within an enhancer-like regulatory sequence 71 kb upstream of the MYB transcriptional start site (-71 LDB1 complex binding site) [PMID: 24614105]. rs6920211 (C) associated with elevated HbF levels in a Nigerian cohort with sickle cell disease [PMID: 29879141].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Nigerian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Stadhouders R, Aktuna S, Thongjuea S, Aghajanirefah A, Pourfarzad F, van Ijcken W, Lenhard B, Rooks H, Best S, Menzel S, Grosveld F, Thein SL, Soler E, HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers., J. Clin. Invest. , 124(4), 1699-710, 2014 PubMed
  2. Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018 PubMed
Created on 2018-06-20 17:32:50, Last reviewed on 2019-05-22 16:20:37 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.