IthaID: 3333



Names and Sequences

Functionality: Neutral polymorphism
Common Name: CD 137 ACC>ACT HGVS Name: HBA2:c.414C>T

Context nucleotide sequence:
TGGCTTCTGTGAGCACCGTGCTGAC [C/T] TCCAAATACCGTTAAGCTGGAGCCT (Strand: +)

Comments: Silent mutation found in a non-thalassemic relative of a patient.

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34448
Size: 1 bp
Located at: α2
Specific Location: Exon 3

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Dutch
Inheritance: Quantitative trait
DNA Sequence Determined: No
Detection Methods: Unknown

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Harteveld KL, Heister AJ, Giordano PC, Losekoot M, Bernini LF, Rapid detection of point mutations and polymorphisms of the alpha-globin genes by DGGE and SSCA., Hum. Mutat. , 7(2), 114-22, 1996 PubMed
Created on 2018-05-16 18:54:03, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.