IthaID: 3328



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs165599 HGVS Name: NC_000022.11:g.19969258G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGTTAGCCCCATGGGGACGACTGCC [A/G] GCCTGGGAAACGAAGAGGAGTCAGC (Strand: +)

Comments: SNP (G allele) associated with a lower frequency of pain-related emergency room visits in African-American females with SCD from the walk-PHaSST study.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pain [HP:0012531]

Location

Chromosome: 22
Locus: NG_011526.1
Locus Location: 32519
Size: 1 bp
Located at: COMT
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Zhang Y, Belfer I, Nouraie M, Zeng Q, Goel R, Chu Y, Krasiy I, Krishnamurti L, Association of genetic variation ingene with pain related to sickle cell disease in patients from the walk-PHaSST study., J Pain Res , 11(0), 537-543, 2018 PubMed
Created on 2018-04-03 20:18:47, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.