IthaID: 3306



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 25/26 -GTG [-Gly] HGVS Name: HBB:c.77_79delGTG
Hb Name: Hb M Dothan Protein Info: β 25(B7) - 26(B8) Gly-Glu->0 AND inserted Glu
Also known as: Hb Higashitochigi, Hb HT

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAAGGTGAACGTGGATGAAGTTGGTG [-/GTG] AGGCCCTGGGCAGGTTGGTATCAA (Strand: -)

Comments: Hb M-Dothan associates with the methemoglobin (Met-Hb) phenotype due to a 3 bp deletion causing a single amino acid [-Gly] deletion in the B-helix (B7/B8) of the β globin chain. The in-frame deletion disrupts the close spatial relation between the helical segments B and E and, as a result, indirectly distorts the heme pocket on the E-helix. Found in a young Japanese boy and a 9-months American boy, both presenting with cyanosis.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:Methemoglobinaemia
Stability: Unstable
Oxygen Affinity: Decreased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70671
Size: 3 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Japanese, American
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Fujisawa K, Yamashiro Y, Hattori Y, Ohha Y, Kajita T, Kageyama S, Arita J, Hb Higashitochigi (Hb Ht) [ beta 24(B6) or beta 25(B7) glycine deleted]: a new unstable variant expressing cyanosis., Hemoglobin, 17(5), 467-73, 1993 PubMed
  2. Kutlar F, Hilliard LM, Zhuang L, Patel N, Eroglu B, Meiler SE, Carmichael H, Russell RB, Kutlar A, Hb M Dothan [beta 25/26 (B7/B8)/(GGT/GAG-->GAG//Gly/Glu-->Glu]; a new mechanism of unstable methemoglobin variant and molecular characteristics., Blood Cells Mol. Dis. , 43(3), 235-8, 2009 PubMed
Created on 2018-02-06 17:23:02, Last reviewed on 2024-03-07 11:08:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.