IthaID: 3303



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs4274224 HGVS Name: NG_008841.1:g.31550C>T

Context nucleotide sequence:
AGGGGACTGGGGTCAGGCCTCATTC [A/G] GGTTCCCTAGAGTGGAAAGGATTGG (Strand: +)

Also known as:

Comments: SNP associated with vaso-occlusive crisis episodes in sickle cell disease in Cameroon.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Vaso-occlusive crisis

Location

Chromosome: 11
Locus: NG_008841.1
Locus Location: 31550
Size: 1 bp
Located at: DRD2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Cameroonian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Wonkam A, Mnika K, Ngo Bitoungui VJ, Chetcha Chemegni B, Chimusa ER, Dandara C, Kengne AP, Clinical and genetic factors are associated with pain and hospitalisation rates in sickle cell anaemia in Cameroon., Br. J. Haematol. , 180(1), 134-146, 2018 PubMed
Created on 2018-01-31 17:59:07, Last reviewed on 2018-01-31 18:00:44 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.