IthaID: 3302
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | 3'UTR +46 C>A | HGVS Name: | HBA1:c.*46C>A |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCTTCTTGCCCCTTGGGCCTCCCCC [C/A] AGCCCCTCCTCCCCTTCCTGCACCC (Strand: +)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38320 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Lacerra G, Fiorito M, Musollino G, Di Noce F, Esposito M, Nigro V, Gaudiano C, Carestia C, Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE., Hum. Mutat. , 24(4), 338-49, 2004 PubMed
- Ropero P, González FA, Nieto JM, Villegas A, Sevilla J, Pérez G, Alonso JM, Recasens V, Abio M, Vagace JM, Vanegas RJ, González Fernández B, Martínez R, C>A substitution in NT 46 of the 3' UTR region (the α complex protected region) of the alpha-1 globin gene: a non-deletional mutation or polymorphism?, J. Clin. Pathol., 73(1), 14-16, 2020 PubMed
Created on 2018-01-30 19:12:40,
Last reviewed on 2022-10-21 08:58:28 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.