IthaID: 3301

Names and Sequences

Functionality:	Neutral polymorphism	Pathogenicity:	Benign / Likely Benign
Common Name:	TTS +26 A>G	HGVS Name:	HBA2:c.*136A>G

Context nucleotide sequence:
GCCTGTGTGTGCCTGGGTTCTCTCT [A/G] TCCCGGAATGTGCCAACAATGGAGG (Strand: +)

Also known as:

Comments: The location of this substitution is 48 nucleotides relative to poly A signal (+861 G>A).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

ClinVar

Phenotype

Allele Phenotype:	Neutral
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	34599
Size:	1 bp
Located at:	α2
Specific Location:	3'UTR

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Turkish, South Italian
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Lacerra G, Fiorito M, Musollino G, Di Noce F, Esposito M, Nigro V, Gaudiano C, Carestia C, Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE., Hum. Mutat. , 24(4), 338-49, 2004 PubMed
Lacerra G, Musollino G, Di Noce F, Prezioso R, Carestia C, Genotyping for known Mediterranean alpha-thalassemia point mutations using a multiplex amplification refractory mutation system., Haematologica , 92(2), 254-5, 2007 PubMed
Cardiero G, Musollino G, Friscia MG, Testa R, Virruso L, Di Girgenti C, Caldora M, Colella Bisogno R, Gaudiano C, Manco G, Lacerra G, Effect of Mutations on mRNA and Globin Stability: The Cases of Hb Bernalda/Groene Hart and Hb Southern Italy., Genes (Basel), 11(8), , 2020 PubMed

Created on 2018-01-30 18:36:41, Last reviewed on 2021-05-26 10:19:21 (Show full history)

A/A	Date	Curator(s)	Comments
1	2018-01-30 18:36:41	The IthaGenes Curation Team	Created
2	2018-01-30 18:47:58	The IthaGenes Curation Team	Reviewed. Mutation name added.
3	2018-01-31 16:46:38	The IthaGenes Curation Team	Reviewed. Synonym mutation name removed.
4	2020-10-14 10:31:48	The IthaGenes Curation Team	Reviewed. Origin and Reference added.
5	2020-10-15 12:09:12	The IthaGenes Curation Team	Reviewed. Origin corrected.
6	2021-05-26 10:19:21	The IthaGenes Curation Team	Reviewed. Common name corrected.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.