IthaID: 3301
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | TTS +26 A>G | HGVS Name: | HBA2:c.*136A>G |
Context nucleotide sequence:
GCCTGTGTGTGCCTGGGTTCTCTCT [A/G] TCCCGGAATGTGCCAACAATGGAGG (Strand: +)
Also known as:
Comments: The location of this substitution is 48 nucleotides relative to poly A signal (+861 G>A).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34599 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Turkish, South Italian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Lacerra G, Fiorito M, Musollino G, Di Noce F, Esposito M, Nigro V, Gaudiano C, Carestia C, Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE., Hum. Mutat. , 24(4), 338-49, 2004 PubMed
- Lacerra G, Musollino G, Di Noce F, Prezioso R, Carestia C, Genotyping for known Mediterranean alpha-thalassemia point mutations using a multiplex amplification refractory mutation system., Haematologica , 92(2), 254-5, 2007 PubMed
- Cardiero G, Musollino G, Friscia MG, Testa R, Virruso L, Di Girgenti C, Caldora M, Colella Bisogno R, Gaudiano C, Manco G, Lacerra G, Effect of Mutations on mRNA and Globin Stability: The Cases of Hb Bernalda/Groene Hart and Hb Southern Italy., Genes (Basel), 11(8), , 2020 PubMed
Created on 2018-01-30 18:36:41,
Last reviewed on 2021-05-26 10:19:21 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2018-01-30 18:36:41 | The IthaGenes Curation Team | Created |
2 | 2018-01-30 18:47:58 | The IthaGenes Curation Team | Reviewed. Mutation name added. |
3 | 2018-01-31 16:46:38 | The IthaGenes Curation Team | Reviewed. Synonym mutation name removed. |
4 | 2020-10-14 10:31:48 | The IthaGenes Curation Team | Reviewed. Origin and Reference added. |
5 | 2020-10-15 12:09:12 | The IthaGenes Curation Team | Reviewed. Origin corrected. |
6 | 2021-05-26 10:19:21 | The IthaGenes Curation Team | Reviewed. Common name corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07