IthaID: 3301



Names and Sequences

Functionality: Neutral polymorphism
Common Name: +861 G>A HGVS Name: HBA2:c.*136A>G

Context nucleotide sequence:
GCCTGTGTGTGCCTGGGTTCTCTCT [A/G] TCCCGGAATGTGCCAACAATGGAGG (Strand: +)

Comments: The location of this substitution is 48 nucleotides relative to poly A signal (+861 G>A).

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34599
Size: 1 bp
Located at: α2
Specific Location: 3'UTR

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Turkish
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lacerra G, Fiorito M, Musollino G, Di Noce F, Esposito M, Nigro V, Gaudiano C, Carestia C, Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE., Hum. Mutat. , 24(4), 338-49, 2004 PubMed
  2. Lacerra G, Musollino G, Di Noce F, Prezioso R, Carestia C, Genotyping for known Mediterranean alpha-thalassemia point mutations using a multiplex amplification refractory mutation system., Haematologica , 92(2), 254-5, 2007 PubMed
Created on 2018-01-30 18:36:41, Last reviewed on 2018-01-31 16:46:38 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.