IthaID: 33
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | -22 to +23 (+45 bp duplication) | HGVS Name: | NG_000007.3:g.70573_70617dup |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
ATCTGACTCCTGAGGA [-/CTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGA] GAAGTCTGCCGTTACT (Strand: -)
Also known as:
Comments: The variant is a duplication of a region of 45 nucleotides from -22 to +23 of the HBB cDNA (coordinates: GRCh38.p13, NC_000011.10). This region includes the start codon encoding two open reading frames. Therefore, transcription from the original initiation codon produces an irrelevant seven-residue peptide, while residual translation from the novel initiation codon results in diminished protein of b-globin.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70573 |
| Size: | 45 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Maori |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Blacklock HA, Case J, Chan T, Raizis T, Doocey R, Fellowes A, Royle G, Jackson S, Brennan S, George P, Novel sequence insertion in a Mâori patient with transfusion-dependent beta-thalassaemia., British journal of haematology, 131(3), 400-2, 2005 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2021-10-27 08:00:25 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2020-04-12 19:29:52 | The IthaGenes Curation Team | Reviewed. HGVS name, common name, Chromosome and Locus location corrected. Comment, allele and context sequence added. |
| 4 | 2020-04-13 15:47:37 | The IthaGenes Curation Team | Reviewed. HGVS name corrected. |
| 5 | 2020-04-13 16:04:49 | The IthaGenes Curation Team | Reviewed. |
| 6 | 2021-09-08 15:17:46 | The IthaGenes Curation Team | Reviewed. Type of mutation corrected. |
| 7 | 2021-10-27 08:00:25 | The IthaGenes Curation Team | Reviewed. Gene added. Specific location corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07