IthaID: 3297



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 11-13 (-9bp): (-GTTACTGCC) HGVS Name: HBB:c.34_42delGTTACTGCC
Hb Name: Hb JC-Paz Protein Info: N/A

Context nucleotide sequence:
TCTGACTCCTGAGGAGAAGTCTGCC [-/GTTACTGCC] CTGTGGGGCAAGGTGAACGTGGATGAA (Strand: -)

Also known as:

Comments: Found as a heterozygote. The deletion results in loss of an alanine, a valine and a threonine of the 'A' α-helix of the β-globin chain. Reported in the literature as HBB:c.29_37delCTGCCGTTA, which does not follow the HGVS Sequence Variant Nomeclature recommendations.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70628
Size: 9 bp
Located at: β
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Argentinean
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Scheps KG, Hasenahuer MA, Parisi G, Targovnik HM, García E, Veber ES, Crisp R, Elena G, Varela V, Fornasari MS, Two novel unstable hemoglobin variants due to in-frame deletions of key amino acids in the β-globin chain., Eur. J. Haematol. , 2018 PubMed
Created on 2018-01-22 18:28:48, Last reviewed on 2019-11-08 12:29:56 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.