IthaID: 3290



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs3817621 HGVS Name: NG_013087.1:g.4813C>G

Context nucleotide sequence:
AAGCCAAGTCAAATATCAAGGGTTG [C/G/T] GGGGTTCAGGGTTTGAGGGTCCAGG (Strand: +)

Also known as: -251 C>G

Comments: SNP associated with elevated HbF levels in severely affected Thai β0‑thalassemia/HbE patients.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 4813
Size: 1 bp
Located at: KLF1
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Khamphikham P, Sripichai O, Munkongdee T, Fucharoen S, Tongsima S, Smith DR, Genetic variation of Krüppel-like factor 1 (KLF1) and fetal hemoglobin (HbF) levels in β0-thalassemia/HbE disease., Int. J. Hematol. , 2017 PubMed
Created on 2018-01-08 17:24:53, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.