IthaID: 3285
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs11759328 | HGVS Name: | NC_000006.12:g.129691228C>T |
Context nucleotide sequence:
CAACATAAACACACACTTTCCCTAA [C/T] CTTATGCCTTGATAAAGACTACACA (Strand: +)
Also known as:
Comments: SNP associated with increased HbF levels in a Chinese cohort of patients with β-thalassaemia, as well as in Thai cohort with heterozygous and homozygous haemoglobin E (HbE).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese, Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- He Y, Luo J, Chen Y, Zhou X, Yu S, Jin L, Xiao X, Jia S, Liu Q, ARHGAP18 is a novel gene under positive natural selection that influences HbF levels in β-thalassaemia., Mol. Genet. Genomics , 2017 PubMed
- Jomoui W, Tepakhan W, Yamsri S, Srivorakun H, Fucharoen G, Fucharoen S, A novel SNP rs11759328 on Rho GTPase-activating protein 18 gene is associated with the expression of Hb F in hemoglobin E-related disorders., Ann. Hematol., 99(1), 23-29, 2020 PubMed
Created on 2017-12-14 17:35:21,
Last reviewed on 2020-07-02 09:12:22 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2017-12-14 17:35:21 | The IthaGenes Curation Team | Created |
| 2 | 2020-07-02 09:12:22 | The IthaGenes Curation Team | Reviewed. Reference added. Comment updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07