IthaID: 3285



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs11759328 HGVS Name: NC_000006.12:g.129691228C>T

Context nucleotide sequence:
CAACATAAACACACACTTTCCCTAA [C/T] CTTATGCCTTGATAAAGACTACACA (Strand: +)

Comments: SNP associated with increased HbF levels in a Chinese cohort of patients with β-thalassaemia.

External Links

Location

Chromosome: 6
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: ARHGAP18
Specific Location: Intron 1

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. He Y, Luo J, Chen Y, Zhou X, Yu S, Jin L, Xiao X, Jia S, Liu Q, ARHGAP18 is a novel gene under positive natural selection that influences HbF levels in β-thalassaemia., Mol. Genet. Genomics , 2017 PubMed
Created on 2017-12-14 17:35:21, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.