IthaID: 3263
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs35685045 | HGVS Name: | NG_012649.1:g.90541C>T |
Context nucleotide sequence:
TATTTTACATGCTATAAAAATCACC [C/T] TTTTAAAAGGTACAATTCAGGCCAG (Strand: +)
Also known as:
Comments: SNP associated with HbF in cohorts of Saudi AI haplotype HbS homozygotes. This SNP is in perfect linkage disequilibrium (LD) with rs4527238.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_012649.1 |
| Locus Location: | 90541 |
| Size: | 1 bp |
| Located at: | ANTXR1 |
| Specific Location: | Intron 9 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Saudi |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Vathipadiekal V, Farrell JJ, Wang S, Edward HL, Shappell H, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Alsuliman A, Qutub HO, Simkin I, Farrer LA, Jiang Z, Luo HY, Huang S, Mostoslavsky G, Murphy GJ, Patra PK, Chui DH, Alsultan A, Al-Ali AK, Sebastiani P, Steinberg MH, A candidate transacting modulator of fetal hemoglobin gene expression in the Arab-Indian haplotype of sickle cell anemia., Am. J. Hematol. , 91(11), 1118-1122, 2016 PubMed
- Habara AH, Shaikho EM, Steinberg MH, Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents., Am. J. Hematol. , 2017 PubMed
Created on 2017-09-26 17:28:23,
Last reviewed on 2020-02-19 15:13:05 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2017-09-26 17:28:23 | The IthaGenes Curation Team | Created |
| 2 | 2020-02-19 15:13:05 | The IthaGenes Curation Team | Reviewed. Locus infor added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07