IthaID: 3263



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs35685045 HGVS Name: NG_012649.1:g.90541C>T

Context nucleotide sequence:
TATTTTACATGCTATAAAAATCACC [C/T] TTTTAAAAGGTACAATTCAGGCCAG (Strand: +)

Also known as:

Comments: SNP associated with HbF in cohorts of Saudi AI haplotype HbS homozygotes. This SNP is in perfect linkage disequilibrium (LD) with rs4527238.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 2
Locus: NG_012649.1
Locus Location: 90541
Size: 1 bp
Located at: ANTXR1
Specific Location: Intron 9

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Saudi
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Vathipadiekal V, Farrell JJ, Wang S, Edward HL, Shappell H, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Alsuliman A, Qutub HO, Simkin I, Farrer LA, Jiang Z, Luo HY, Huang S, Mostoslavsky G, Murphy GJ, Patra PK, Chui DH, Alsultan A, Al-Ali AK, Sebastiani P, Steinberg MH, A candidate transacting modulator of fetal hemoglobin gene expression in the Arab-Indian haplotype of sickle cell anemia., Am. J. Hematol. , 91(11), 1118-1122, 2016 PubMed
  2. Habara AH, Shaikho EM, Steinberg MH, Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents., Am. J. Hematol. , 2017 PubMed
Created on 2017-09-26 17:28:23, Last reviewed on 2020-02-19 15:13:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.